Tools‎ > ‎SAMtools‎ > ‎

SAM file format

The Sequence Alignment/Map (SAM) is a file format to save alignment information of short reads mapped against reference sequences. It usually starts with a header section followed by alignment information as tab separated lines for each read.

Header section
@HD    VN:1.3    SO:coordinate
@SQ    SN:conticA    LN:443
@SQ    SN:contigB    LN:1493
@SQ    SN:contigC    LN:328

Tab-delimited read alignment information lines
readID43GYAX15:7:1:1202:19894/1    256    contig43    613960    1    65M    *    0    0    CCAGCGCGAACGAAATCCGCATGCGTCTGGTCGTTGCACGGAACGGCGGCGGTGTGATGCACGGC    EDDEEDEE=EE?DE??DDDBADEBEFFFDBEFFEBCBC=?BEEEE@=:?::?7?:8-6?7?@??#    AS:i:0    XS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:65  YT:Z:UU

readID43GYAX15:7:1:1202:19894/1    272    contig32    21001    1    65M    *    0    0    GCCGGACGTCACACGGCCGCCGGGCCGGTCTACGACCAGACGCATGCGGATTTCGTTAGAGCCGG    #??@?7?6-8:?7?::?:=@EEEEB?=CBCBEFFEBDFFFEBEDABDDD??ED?EE=EEDEEDDE    AS:i:-5    XS:i:0   XN:i:0  XM:i:1   XO:i:0   XG:i:0   NM:i:1   MD:Z:42T22   YT:Z:UU

readID43GYAX15:7:1:1202:19894/1    256    contig87    540849    1    65M    *    0    0    CCTGCACGAACGAAATCCGCATGCGTCTGGTCGTTGTACGGAACGGCGGTTGTGTGACGAACGGC    EDDEEDEE=EE?DE??DDDBADEBEFFFDBEFFEBCBC=?BEEEE@=:?::?7?:8-6?7?@??# AS:i:0  XS:i:0 XN:i:0  XM:i:0 XO:i:0  XG:i:0  NM:i:0    MD:Z:65    YT:Z:UU


Meaning of columns

QNAME    FLAG    RNAME    POS    MAPQ    CIGAR    RNEXT    PNEXT    TLEN    SEQ    QUAL    TAGS
  1. Read Name
  2. SAM flag --> decode
  3. contig name or * for unmapped
  4. mapped position of base 1 of a read on the reference sequence
  5. MAPQ mapping quality
  6. CIGAR string describing insertions and deletions
  7. Name of mate
  8. Position of mate
  9. Template length
  10. Read Sequence
  11. Read Quality
  12. Additional information in TAG:TYPE:VALUE format

Read also

SAM Format Specification (PDF)

→ How to filter reads using the SAM flags? (How to count the number of reads?)